In Drosophila embryos, blood development (hematopoiesis) is initiated in the head mesoderm, from where blood cells (hemocytes) migrate throughout the developing embryo. These embryonic hemocytes generate two lineages: the plasmatocytes, which differentiate into macrophages and migrate all over the embryo, and the crystal cells in the region of the anterior midgut. Genes involved in vertebrate hematopoiesis and vasculogenesis are also conserved and function during Drosophila hematopoiesis (Tepass et al. 1994; Rehorn et al. 1996; Lebestky et al. 2000; Cho et al. 2002; Duvic et al. 2002). Several transcription factors control hematopoiesis in Drosophila. The GATA factor Serpent (encoded by srp) is required for the development of all hemocytes (Rehorn et al. 1996). Crystal cell specification depends on the Runx-1 domain AML-1 ortholog Lozenge (encoded by lz; Lebestky et al. 2000) and also requires Notch signalling (Duvic et al. 2002) but is antagonised by the Friend-of-GATA homologue U-shaped (encoded by ush; Fossett et al. 2001). Plasmatocyte identity is specified by the zinc-finger transactivator Glial Cells Missing (gcm; Bernardoni et al. 1997). The vertebrate vascular endothelial growth factor (VEGF) signalling system is important for early vasculogenesis and hematopoiesis and directs the localisation of blood and vascular progenitors in mouse. Cho et al. (2002) have shown that Drosophila embryonic hemocytes also express VEGFs and a VEGF receptor, involved in guiding blood cell migration. Several studies underline the existence of parallels in the genetic control of hematopoiesis in Drosophila and in mammals (reviewed in Traver and Zon 2002). Hence, the identification of additional players in both vertebrate and invertebrate hematopoiesis should allow the rapid elucidation of molecular pathways involved in the development of these lineages.

In order to understand the genetic controls underlying hematopoietic and vascular development in mammals and blood development in Drosophila, we are analysing candidate genes for their role in hematopoiesis. Here we describe the expression of one such gene in Drosophila. The gene asrij was identified in mouse (manuscript submitted for publication) in a study designed to search for genes expressed in the mouse vasculature. An homology-based search of the public domain database (http://www.ncbi.nlm.nih.gov/BLAST) revealed that mouse Asrij (247 amino acids) shares a 28% identity with a novel predicted Drosophila protein of 257 amino acids encoded by the gene CG13533 (cytological map position 59B4; http://flybase.bio.indiana.edu). The gene CG13533 is predicted to be 1,185 bp with three exons. An EST (AT12418, 1,087 bp) from an adult testis cDNA library, corresponding to the CG13533 cDNA, was reported by the Drosophila EST project. Asrij is a predicted transmembrane protein with two transmembrane regions from amino acids 41–61 and 71–92.

To analyse the spatial expression pattern of asrij in Drosophila embryos, we performed whole-mount mRNA in situ hybridisation. Embryos were hybridised by standard procedures (Lehmann and Tautz 1994) with a 429-bp fragment PCR-amplified from wild-type genomic DNA (forward primer 5′GGAGGAGGTGAAGGCGTTACGT3′ and reverse primer 5′AGATTGAGAGAAGTGCTCCT3′) and digoxigenin-labelled (Hoffman La Roche) according to the manufacturer's instructions. In situ hybridisation on wild-type (CS) Drosophila embryos revealed low levels of CG13533 mRNA ubiquitously in the blastoderm (Fig. 1A). Strong expression is detected in the pole cells from stage 4 of embryogenesis and this expression persists till the extended germband stage (Fig. 1A, G–J arrows). Expression is stronger in the cephalic furrow, ventral furrow and posterior invagination during gastrulation (Fig. 1B, K–N). The hybridisation signal suggests that the mRNA is asymmetrically localised (Fig. 1K–N). From about stage 8 (Fig. 1C), expression is detected in the presumptive head region with stronger expression in the prohemocytic region (Fig. 1C′). Later Dmasrij RNA becomes restricted to cells scattered throughout the embryo (Fig. 1D–F). The scattered cells are localised initially in the anterior head region, gnathal buds and amnioserosa (Fig. 1D), then dorsally in the posterior region and amnioserosa (Fig. 1E, O). From stage 11, strong expression is seen in scattered cells in the anterior-most regions as well as throughout the embryo (Fig. 1E, F, O, P)). This pattern is strongly reminiscent of the pattern of origin and migration of embryonic hemocytes, described by Tepass et al. (1994). Strong expression is also seen in the tracheal pits from stage 10 (Fig. 1D, E, O, Q). The expression analysis suggests that CG13533, to which we give the name Dmasrij, is predominantly expressed in the Drosophila hemocytes.

Fig. 1A–Q.
figure 1

Drosophila melanogaster asrij mRNA expression. In situ hybridization showing distribution of Dm asrij mRNA at embryonic stages indicated in the wild type. A–F Low magnification views at different embryonic stages as indicated. G–Q High magnification views of selected embryonic regions. A Expression is seen at early stage 4 in pole cells (arrow; higher magnification in G). B Expression in the cephalic furrow (cf) and ventral furrow (vf). C Anterior expression in the head mesoderm (arrow) at stage 8. C′ Inset showing prohemocytic region of a different embryo at higher magnification. D By stage 10 expression is seen in the clypeolabrum (cl), the gnathal buds (gb) and in posterior segments (arrow). Expression is also detected in tracheal cells (region around the asterisk, magnified in Q) and very strong expression is seen in the amnioserosa (as). E By late stage 11, increasing expression is seen in the clypeolabrum, the gnathal buds and in scattered cells throughout the anterior and posterior (arrows; see O). F Stage-13 embryo showing asrij-expressing cells in the anterior and in a scattered fashion throughout the embryo (arrows; see P). G–J Magnified view of asrij expression seen in the pole cells (arrows) at the various stages indicated. K–M Higher magnification views of a part of the cephalic furrow (K), ventral furrow (L) and posterior invagination (M) from a stage-6 embryo. Region around the arrow in M is further magnified in N. Arrows point to a few examples of cells showing asymmetric RNA localisation. O, P Montages showing a magnified view of E and F, respectively, showing distribution of hemocytes in the anterior and posterior of the embryo. Arrows point to scattered hemocytes. Q A magnified view of the region around the asterisk in D, showing tracheal expression (arrowheads) of Dmasrij mRNA. Anterior is to the left in all views; A, C–K, M–P dorsal is up; B,L ventrolateral views. L and N are rotated 90  counter-clockwise; anterior is at the bottom, dorsal is to the left

Full size image

Embryos homozygous for the deletion 3909 [Df (2R)59AD; breakpoints 59A01–03;59D01–04] do not express Dmasrij or the blood cell marker Croquemort (Franc et al. 1996; Fig. 2A, compare with B). Df3909 homozygous embryos older than about stage 12 could not be detected, presumably because of lethality before this stage. The lack of Dmasrij expression in 3909 homozygotes suggests that Dmasrij is located between breakpoints 59A01–03;59D01–04 or that the deficiency uncovers a gene that represses Dmasrij completely.

Fig. 2A–F.
figure 2

Dm asrij expression analysis in mutants. Anti-Croquemort antibody staining of deficiency (3909) embryo (A) and wild-type embryo (B) at comparable stages. Arrows point to anterior mesoderm that lacks hemocytes in 3909 embryos (compare with B). Non-specific staining in the yolk and amnioserosa is seen in A and B. C–F mRNA in situ hybridization showing distribution of Dm asrij mRNA in the blastoderm (C) and gastrulating (D) embryos derived from BicD/+ mothers. Arrows indicate Dmasrij-expressing pole cells in the anterior. Arrowhead indicates posterior pole cells. E Expression of asrij mRNA is restricted to the anterior (arrow) in srp (serpent) embryos and is not seen in the scattered pattern in the wild type (compare with F). Anterior is to the left and dorsal is up in all views

Full size image

To further investigate whether the anterior staining seen in wild-type embryos is indeed due to zygotic Dmasrij expression in hemocytes, we examined embryos that have the Dmasrij gene but lack hemocytes. Embryos derived from BicaudalD mothers (BicD/+; BicD7134, obtained from the Tuebingen Stock Centre) show a duplication of posterior structures at the anterior and lack anterior-derived structures including hemocytes (Wharton and Struhl 1989). These embryos did not show any Dmasrij staining in the scattered hemocyte pattern (Fig. 2C, D). This suggests that the wild-type expression pattern in what appear to be hemocytes is indeed due to zygotic Dmasrij expression in these cells. However, in embryos derived from BicD mothers, Dmasrij expression is present in posterior pole cells and in duplicated pole cells in the anterior (Fig. 2C, D arrows).

Serpent (srp) embryos also lack hemocytes as srp is required for hemocyte precursor specification (Rehorn et al. 1996). Embryos homozygous for a null allele of srp (srp 01549, obtained from the Bloomington Drosophila Stock Centre), did not show Dmasrij expression in the scattered hemocyte pattern, as expected, due to the absence of hemocytes (Fig. 2E, compare with F). However Dmasrij is expressed all over the anterior region of srp embryos, including the prohemocytic region (Fig. 2E arrow). This suggests that srp is not required for Dmasrij expression.

We have shown that Drosophila asrij is expressed in the pole cells, amnioserosa and from the earliest stages of hematopoietic and tracheal development in Drosophila. Asrij expression continues throughout embryonic hemocyte development. The asrij expression pattern partly resembles that of the Drosophila VEGF receptor homologue (DmVEGFR) and its ligands (Heino et al. 2001), which are shown to play a role in hemocyte migration (Cho et al. 2002). Further analysis of asrij and its interaction with known hematopoietic transcription factors and signalling molecules in Drosophila will allow us to elucidate early events in Drosophila and also vertebrate hematopoiesis.